Iit Bhilai Tenders - 293 current Tenders in Iit Bhilai 2025 published on e-Procurement & e-Tenders website.

Keep an eye on local newspapers such as The Times of India, Hindustan Times etc. for government tenders in Iit Bhilai. Visit the website of the Government Tenders for Iit Bhilai Tenders. Check the Government e-Marketplace (GeM) (https://gem.gov.in/) for government tenders related to various goods and services in Iit Bhilai. It's important to regularly check Iit Bhilai tenders webpage and stay updated on the latest tender opportunities in Iit Bhilai. Additionally, make sure to thoroughly analyze and understand the requirements of each tender before submitting a bid on e-Procurement website for tenders in Iit Bhilai.

1

Government Departments - IIT Bhilai GEC Campus Sejbahar Raipur - Chhattisgarh

30413912 Corrigendum : supply and installation of spectrometer based photoreactor at iit bhilai supply and installation of spectrometer based photoreactor at iit bhilai , spectrometer based photoreactor as per specification in page no 13 in the tender documents. , optional it

Due Date : Jan 17, 2022
Tender Value : Ref. Document
View Notice
2

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

30302978 Corrigendum : supply and installation of low frequency noise measurement setup at iit bhilai supply and installation of low frequency noise measurement setup at iit bhilai , supply and installation of dynamic signal analyzer at iit bhilai ( as per the technical sp

Due Date : Dec 30, 2021
Tender Value : Ref. Document
View Notice
3

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

30302975 supply of lab consumables at iit bhilai supply of lab consumables at iit bhilai , ptaa(100mg) , dcm (1l x 2) , 2-thiophenethylamine (5g) , ipa (2.5l) , tbapf6 (25g) , agbr (5g) , fabr (5g) , hydrobromic acid (500ml)

Due Date : Dec 27, 2021
Tender Value : Ref. Document
View Notice
4

Government Departments - IIT Bhilai GEC Campus Old Dhamtari Road Sejbahar - Chhattisgarh

30302930 supply of lab chemicals at iit bhilai supply of lab chemicals at iit bhilai , diethylzinc ( 15% in toluene ) ( product code- d3902 ) ( preferred make: tci ) - 100 ml , bromopentacarbonylmanganese ( i ) ( preferred make: alfa ) - 1 gm , chloro

Due Date : Dec 27, 2021
Tender Value : Ref. Document
View Notice
5

Government Departments - IIT Bhilai, Kutelabhata, Khapri - Chhattisgarh

30209299 Corrigendum : supply and installation of 2kw fiber laser system at iit bhilai supply and installation of 2kw fiber laser system at iit bhilai

Due Date : Jan 17, 2022
Tender Value : Ref. Document
View Notice
6

Government Departments - IIT Bhilai, GEC Campus, Sejbahar - Chhattisgarh

30187862 Corrigendum : supply of optical chopper and accessories at iit bhilai supply of optical chopper and accessories at iit bhilai , supply of optical chopper and accessories at iit bhilai , optical chopper system with slot (36°) chopper blade 230 vac power cord. , 10/100 s

Due Date : Jan 1, 2022
Tender Value : Ref. Document
View Notice
7

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

30172417 supply and installation of data acquisition card at iit bhilai supply and installation of data acquisition card at iit bhilai , 32 channel voltage card, 250ks / s aggregate, 16 bit resolution, nominal input ranges ±10 v, ±5 v, ±1 v, ±0.2 v

Due Date : Jan 4, 2022
Tender Value : Ref. Document
View Notice
8

Government Departments - IIT Bhilai, KutelaBhata Campus, Khapri, Durg Dist - Chhattisgarh

30037649 Corrigendum : supply and installation of hot and cold rolling mill at iit bhilai supply and installation of hot and cold rolling mill at iit bhilai , supply and installation of hot and cold rolling mill with associated accessories at iit bhilai ( as per the technical

Due Date : Jan 17, 2022
Tender Value : Ref. Document
View Notice
9

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

30037245 supply of chemicals for solar cell fabrication at iit bhilai supply of chemicals for solar cell fabrication at iit bhilai , supply of chemicals for solar cell fabrication at iit bhilai , ptaa - 100 grams , fullerene - c60-1 gram - purity 99.5% , pcbm - 10

Due Date : Dec 13, 2021
Tender Value : Ref. Document
View Notice
10

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

30037186 supply of chemicals for solar cell fabrication at iit bhilai supply of chemicals for solar cell fabrication at iit bhilai , supply of chemicals for solar cell fabrication at iit bhilai , formamidinium iodide ( fai ) - 10g - 99.99 , methylammoni

Due Date : Dec 14, 2021
Tender Value : Ref. Document
View Notice
11

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

29780896 Corrigendum : supply and installation of probe station at iit bhilai supply and installation of probe station at iit bhilai , supply and installation of probe station at iit bhilai ( as per the technical specifications mentioned in the tender document page no. 15 to

Due Date : Nov 30, 2021
Tender Value : rupee 25 Lakhs
View Notice
12

Government Departments - IIT Bhilai, GEC Campus, Raipur - Chhattisgarh

29710253 Corrigendum : supply, installation and commissioning of flash chromatography system with accessories at iit bhilai supply, installation and commissioning of flash chromatography system with accessories at iit bhilai , supply installation and commissioning of flash c

Due Date : Nov 22, 2021
Tender Value : Ref. Document
View Notice
13

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

29694566 Corrigendum : supply and installation of fluorescence microscope at iit bhilai supply and installation of fluorescence microscope at iit bhilai , supply and installation of fluorescence microscope at iit bhilai(as per the technical specifications mentioned in the tend

Due Date : Nov 24, 2021
Tender Value : Ref. Document
View Notice
14

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

29565625 providing web services for dsai courses at iit bhilai providing web services for dsai courses at iit bhilai

Due Date : Nov 2, 2021
Tender Value : Ref. Document
View Notice
15

Government Departments - IIT Bhilai, GEC Campus, Sejabahar, Raipur - Chhattisgarh

29524555 Corrigendum : supply and installation of hall effect measurement system at iit bhilai supply and installation of hall effect measurement system at iit bhilai , supply and installation of hall effect measurement system at iit bhilai ( as per the technical specificatio

Due Date : Nov 29, 2021
Tender Value : Ref. Document
View Notice
16

Government Departments - IIT Bhilai, GEC Campus Raipur - Chhattisgarh

29506587 supply of lab consumables at iit bhilai supply of lab consumables at iit bhilai , supply of lab consumables at iit bhilai , 2-chloroethyl vinyl ether - 25 g*2 - aldrich , glove - medium - , 4-vinylphenylboronic acid - 5 gm*2 - sigma , 4-vinylbenzyl

Due Date : Nov 1, 2021
Tender Value : Ref. Document
View Notice
17

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

29464760 Corrigendum : supply and installation of high-speed confocal laser scanning microscope with incubator facility at iit bhilai supply and installation of high-speed confocal laser scanning microscope with incubator facility at iit bhilai , import components: supply and i

Due Date : Nov 3, 2021
Tender Value : Ref. Document
View Notice
18

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

29435734 Corrigendum : supply and installation of high resolution transmission electron microscope with accessories at iit bhilai supply and installation of high resolution transmission electron microscope with accessories at iit bhilai ,

Due Date : Nov 29, 2021
Tender Value : Ref. Document
View Notice
19

Government Departments - IIT Bhilai, GEC Campus, Raipur - Chhattisgarh

29421345 supply of dna oligomer sequence at iit bhilai supply of dna oligomer sequence at iit bhilai , str1 [amc12]aatgctcttagatgctagtat , str2 [amc12]ctaagagcattatactagcat

Due Date : Oct 20, 2021
Tender Value : Ref. Document
View Notice
20

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

29388547 Corrigendum : supply and installation of maskless photolithography with uv direct laser writer at iit bhilai supply and installation of maskless photolithography with uv direct laser writer at iit bhilai , main unit and import components: supply and installation of mas

Due Date : Nov 8, 2021
Tender Value : Ref. Document
View Notice
21

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

29358333 Corrigendum : supply of automatic spin coating system at iit bhilai supply of automatic spin coating system at iit bhilai , automatic spin coating system , automatic spin coating system

Due Date : Nov 1, 2021
Tender Value : Ref. Document
View Notice
22

Government Departments - IIT Bhilai, GEC Campus, Sejbahar Raipur - Chhattisgarh

29234584 supply of lab consumables at iit bhilai supply of lab consumables at iit bhilai , [ ( ch3cn ) 4cu ] pf6- 5 g , 1, 5-bis ( diphenylphosphino ) pentane - 5 g , 1, 6-bis ( diphenylphosphino ) hexane - 5 g , 2-phenylpyridine - 10 g , copper ( i ) oxid

Due Date : Sep 28, 2021
Tender Value : Ref. Document
View Notice
23

Government Departments - IIT Bhilai, GEC Campus, Raipur - Chhattisgarh

29154881 Corrigendum : supply, installation and commissioning of automated column chromatography for molecular separation with accessories at iit bhilai supply, installation and commissioning of automated column chromatography for molecular separation with accessories at iit bh

Due Date : Oct 6, 2021
Tender Value : Ref. Document
View Notice
24

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

29111573 supply of gold at iit bhilai supply of gold at iit bhilai , gold , gold purity99.90% pellets / wire ( preferably 1mm diameter )

Due Date : Sep 20, 2021
Tender Value : Ref. Document
View Notice
25

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

29041646 Corrigendum : supply and installation of spectral domain based high-speed optical coherence tomography system at iit bhilai supply and installation of spectral domain based high-speed optical coherence tomography (oct) system at iit bhilai ,

Due Date : Oct 18, 2021
Tender Value : Ref. Document
View Notice
26

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

29005729 Corrigendum : supply and installation of usb vision camera with zoom system and accessories at iit bhilai supply and installation of usb vision camera with zoom system and accessories at iit bhilai , supply and installation of usb vision camera with zoom system and ac

Due Date : Oct 12, 2021
Tender Value : Ref. Document
View Notice
27

Government Departments - IIT Bhilai Raipur - Chhattisgarh

28890121 Corrigendum : supply and installation of ellipsometer at iit bhilai supply and installation of ellipsometer at iit bhilai , supply and installation of ellipsometer at iit bhilai ( as per the technical specifications mentioned in the tender document page no. 13 to 14

Due Date : Oct 4, 2021
Tender Value : Ref. Document
View Notice
28

Government Departments - IIT Bhilai Raipur - Chhattisgarh

28874303 supply of chemicals for solar cells fabrication at iit bhilai supply of chemicals for solar cells fabrication at iit bhilai , pbbr2 - 25 g - tci , csi - 10 g - sigma-aldrich , csbr - 20 g - sigma-aldrich , tin ( ii ) chloride dihydrate - 100 g - sigm

Due Date : Sep 2, 2021
Tender Value : Ref. Document
View Notice
29

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

28855640 Corrigendum : supply and installation of time resolved photo luminescence setup with accessories at iit bhilai supply and installation of time resolved photo luminescence setup with accessories at iit bhilai , main unit and import components: supply and installation o

Due Date : Sep 30, 2021
Tender Value : Ref. Document
View Notice
30

Government Departments - IIT Bhilai. GEC Campus, Sejbahar, Raipur - Chhattisgarh

28841144 Corrigendum : supply and installation of gamma ray spectrometer at iit bhilai supply and installation of gamma ray spectrometer at iit bhilai , supply and installation of gamma ray spectrometer at iit bhilai(as per the technical specifications mentioned in the tender

Due Date : Oct 4, 2021
Tender Value : Ref. Document
View Notice
31

Government Departments - IIT Bhilai - Chhattisgarh

28812090 Corrigendum : engagement of internal auditor for iit bhilai engagement of internal auditor for iit bhilai

Due Date : Sep 2, 2021
Tender Value : Ref. Document
View Notice
32

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

28733028 supply of gold at iit bhilai supply of gold at iit bhilai , gold , gold purity99.99%

Due Date : Aug 17, 2021
Tender Value : Ref. Document
View Notice
33

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

28682128 supply of polystyrene micro-particles at iit bhilai supply of polystyrene micro-particles at iit bhilai , supply of polystyrene micro-particles at iit bhilai , plane non- functionalized polystyrene micro-particles(technical specification as per niq) , fl

Due Date : Aug 16, 2021
Tender Value : Ref. Document
View Notice
34

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

28601738 supply and installation of stir casting machine with accessories at iit bhilai supply and installation of stir casting machine with accessories at iit bhilai , supply and installation of stir cast machine at iit bhilai including essential accessories (

Due Date : Aug 16, 2021
Tender Value : Ref. Document
View Notice
35

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

28601340 Corrigendum : supply of workstation (laptop) at iit bhilai supply of workstation (laptop) at iit bhilai , supply of workstation (laptop) at iit bhilai(as per the specifications mentioned in the enquiry document)

Due Date : Aug 19, 2021
Tender Value : Ref. Document
View Notice
36

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

28577094 supply and installation of spectrometer with emccd detector and light source at iit bhilai supply and installation of spectrometer with emccd detector and light source at iit bhilai , supply and installation of spectrometer with emccd detector and light

Due Date : Aug 24, 2021
Tender Value : Ref. Document
View Notice
37

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipu - Chhattisgarh

28472217 Corrigendum : supply and installation of maskless photolithography with uv direct laser writer at iit bhilai

Due Date : Aug 30, 2021
Tender Value : Ref. Document
View Notice
38

Government Departments - IIT Bhilai, Kutelabhata, Durg - Chhattisgarh

28406583 Corrigendum : supply and installation of high resolution transmission electron microscope with accessories at iit bhilai

Due Date : Aug 30, 2021
Tender Value : Ref. Document
View Notice
39

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

28337422 Corrigendum : empanelment of potential supplier for laboratory chemicals , glassware and labware at iit bhilai

Due Date : Jul 29, 2021
Tender Value : Ref. Document
View Notice
40

Government Departments - IIT Bhilai - Chhattisgarh

28315861 Corrigendum : supply and installation of cryogen free closed cycle refrigerator at iit bhilai

Due Date : Jul 31, 2021
Tender Value : Ref. Document
View Notice
41

Government Departments - IIT Bhilai, GEC Campus, Sejabhar, Raipur - Chhattisgarh

28287891 Corrigendum : supply and installation of nuclear magnetic resonance ( nmr ) spectrometer with accessories at iit bhilai

Due Date : Aug 17, 2021
Tender Value : Ref. Document
View Notice
42

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

28259185 Corrigendum : supply and installation of michelson interferometer , optical fibre experiment and zeemann effect apparatus at iit bhilai

Due Date : Aug 3, 2021
Tender Value : Ref. Document
View Notice
43

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

28113697 supply and installation of spin coater at iit bhilai

Due Date : Jun 24, 2021
Tender Value : Ref. Document
View Notice
44

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

28087201 supply of function generator at iit bhilai

Due Date : Jun 24, 2021
Tender Value : Ref. Document
View Notice
45

Government Departments - IIT Bhilai, Raipur - Chhattisgarh

28075136 supply of tube roller mixer for iit bhilai

Due Date : Jun 17, 2021
Tender Value : Ref. Document
View Notice
46

Government Departments - IIT Bhilai - Chhattisgarh

28012816 supply of chemical and sputtering target at iit bhilai

Due Date : Jun 10, 2021
Tender Value : Ref. Document
View Notice
47

Government Departments - IIT Bhilai - Chhattisgarh

28012805 supply of gold at iit bhilai

Due Date : Jun 10, 2021
Tender Value : Ref. Document
View Notice
48

Government Departments - IIT Bhilai, GEC Campus Sejbahar, Raipur - Chhattisgarh

27937388 Corrigendum : supply of turbo molecular pumping system at iit bhilai

Due Date : Jun 24, 2021
Tender Value : Ref. Document
View Notice
49

Government Departments - IIT Bhilai, GEC Campus, Sejbahar, Raipur - Chhattisgarh

27893841 supply of mounted led royal blue for microscope with driver at iit bhilai

Due Date : May 27, 2021
Tender Value : Ref. Document
View Notice
50

Government Departments - IIt Bhilai Raipur - Chhattisgarh

27887224 supply of sports consumables

Due Date : May 27, 2021
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail